pLenti-CMVtight-HNF1A-FLAG-Hygro
              
              
                (Plasmid
                
                #183232)
              
            
            
            
          - 
            PurposeLentiviral vector; Tet-on advanced system driving the expression of tagged HNF1A
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLenti CMVtight Hygro DEST
- 
              Backbone manufacturerEric Campeau
- 
              Vector typeLentiviral
- 
                Selectable markersHygromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameHNF1 homeobox A
- 
                  Alt nameHNF1A
- 
                    SpeciesH. sapiens (human)
- 
                        Entrez GeneHNF1A (a.k.a. HNF-1-alpha, HNF-1A, HNF1, HNF1alpha, HNF4A, IDDM20, LFB1, MODY3, TCF-1, TCF1)
- Promoter tight TRE
- 
    
        Tags
        / Fusion Proteins
    - FLAG tag (C terminal on insert)
- AviTag (C terminal on insert)
 
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGGCAGGGATATTCACCATT
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLenti-CMVtight-HNF1A-FLAG-Hygro was a gift from Jorge Ferrer (Addgene plasmid # 183232 ; http://n2t.net/addgene:183232 ; RRID:Addgene_183232)
- 
                For your References section: The HASTER lncRNA promoter is a cis-acting transcriptional stabilizer of HNF1A. Beucher A, Miguel-Escalada I, Balboa D, De Vas MG, Maestro MA, Garcia-Hurtado J, Bernal A, Gonzalez-Franco R, Vargiu P, Heyn H, Ravassard P, Ortega S, Ferrer J. Nat Cell Biol. 2022 Oct 6. pii: 10.1038/s41556-022-00996-8. doi: 10.1038/s41556-022-00996-8. 10.1038/s41556-022-00996-8 PubMed 36202974
