Skip to main content

pLenti-CMVtight-HNF1A-FLAG-Hygro
(Plasmid #183232)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183232 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti CMVtight Hygro DEST
  • Backbone manufacturer
    Eric Campeau
  • Vector type
    Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HNF1 homeobox A
  • Alt name
    HNF1A
  • Species
    H. sapiens (human)
  • Entrez Gene
    HNF1A (a.k.a. HNF-1-alpha, HNF-1A, HNF1, HNF1alpha, HNF4A, IDDM20, LFB1, MODY3, TCF-1, TCF1)
  • Promoter tight TRE
  • Tags / Fusion Proteins
    • FLAG tag (C terminal on insert)
    • AviTag (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGGCAGGGATATTCACCATT
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CMVtight-HNF1A-FLAG-Hygro was a gift from Jorge Ferrer (Addgene plasmid # 183232 ; http://n2t.net/addgene:183232 ; RRID:Addgene_183232)
  • For your References section:

    The HASTER lncRNA promoter is a cis-acting transcriptional stabilizer of HNF1A. Beucher A, Miguel-Escalada I, Balboa D, De Vas MG, Maestro MA, Garcia-Hurtado J, Bernal A, Gonzalez-Franco R, Vargiu P, Heyn H, Ravassard P, Ortega S, Ferrer J. Nat Cell Biol. 2022 Oct 6. pii: 10.1038/s41556-022-00996-8. doi: 10.1038/s41556-022-00996-8. 10.1038/s41556-022-00996-8 PubMed 36202974