pOC2 Tubb3 no donor
(Plasmid
#183431)
-
PurposeCreOFF gRNA expression for beta3-tubulin (amino acid position: stop codon)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepOC2
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequenceGCTGCGAGCAACTTCACTT
-
SpeciesM. musculus (mouse), R. norvegicus (rat)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer ctagtccgtttttagcgcgt
- 3′ sequencing primer cgggccatttaccgtaagtt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOC2 Tubb3 no donor was a gift from Harold MacGillavry (Addgene plasmid # 183431 ; http://n2t.net/addgene:183431 ; RRID:Addgene_183431) -
For your References section:
Duplex Labeling and Manipulation of Neuronal Proteins Using Sequential CRISPR/Cas9 Gene Editing. Droogers WJ, Willems J, MacGillavry HD, de Jong APH. eNeuro. 2022 Jul 18;9(4):ENEURO.0056-22.2022. doi: 10.1523/ENEURO.0056-22.2022. 10.1523/ENEURO.0056-22.2022 PubMed 35851300