Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pORANGE Tubb3-3xGFP KI
(Plasmid #183444)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 183444 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pORANGE
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA and 3xGFP donor
  • gRNA/shRNA sequence
    GCTGCGAGCAACTTCACTT
  • Species
    M. musculus (mouse), R. norvegicus (rat)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer aaggctgttagagagataattggaa
  • 3′ sequencing primer cgggccatttaccgtaagtt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pORANGE Tubb3-3xGFP KI was a gift from Harold MacGillavry (Addgene plasmid # 183444 ; http://n2t.net/addgene:183444 ; RRID:Addgene_183444)
  • For your References section:

    Duplex Labeling and Manipulation of Neuronal Proteins Using Sequential CRISPR/Cas9 Gene Editing. Droogers WJ, Willems J, MacGillavry HD, de Jong APH. eNeuro. 2022 Jul 18;9(4):ENEURO.0056-22.2022. doi: 10.1523/ENEURO.0056-22.2022. 10.1523/ENEURO.0056-22.2022 PubMed 35851300