Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-CaMKIIa-rsChRmine-oScarlet-KV 2.1-WPRE
(Plasmid #183523)


Item Catalog # Description Quantity Price (USD)
Plasmid 183523 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5384
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    Synthetic; derived from Tiarina fusus
  • Insert Size (bp)
  • Mutation
  • Promoter CaMKIIa

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTGGATGCTGACGAAGGCTCG
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-rsChRmine-oScarlet-KV 2.1-WPRE was a gift from Karl Deisseroth (Addgene plasmid # 183523 ; ; RRID:Addgene_183523)
  • For your References section:

    Structural basis for channel conduction in the pump-like channelrhodopsin ChRmine. Kishi KE, Kim YS, Fukuda M, Inoue M, Kusakizako T, Wang PY, Ramakrishnan C, Byrne EFX, Thadhani E, Paggi JM, Matsui TE, Yamashita K, Nagata T, Konno M, Quirin S, Lo M, Benster T, Uemura T, Liu K, Shibata M, Nomura N, Iwata S, Nureki O, Dror RO, Inoue K, Deisseroth K, Kato HE. Cell. 2022 Feb 17;185(4):672-689.e23. doi: 10.1016/j.cell.2022.01.007. Epub 2022 Feb 2. 10.1016/j.cell.2022.01.007 PubMed 35114111