Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-Ef1a DIO-rsChRmine-oScarlet-Kv2.1-WPRE
(Plasmid #183529)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 183529 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-Ef1a DIO
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5577
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rsChRmine-oScarlet-Kv2.1
  • Species
    Synthetic; derived from Tiarina fusus
  • Insert Size (bp)
    1905
  • Mutation
    I146M/G174S
  • Promoter Ef1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GTTAGGCCAGCTTGGCACTTG
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a DIO-rsChRmine-oScarlet-Kv2.1-WPRE was a gift from Karl Deisseroth (Addgene plasmid # 183529 ; http://n2t.net/addgene:183529 ; RRID:Addgene_183529)
  • For your References section:

    Structural basis for channel conduction in the pump-like channelrhodopsin ChRmine. Kishi KE, Kim YS, Fukuda M, Inoue M, Kusakizako T, Wang PY, Ramakrishnan C, Byrne EFX, Thadhani E, Paggi JM, Matsui TE, Yamashita K, Nagata T, Konno M, Quirin S, Lo M, Benster T, Uemura T, Liu K, Shibata M, Nomura N, Iwata S, Nureki O, Dror RO, Inoue K, Deisseroth K, Kato HE. Cell. 2022 Feb 17;185(4):672-689.e23. doi: 10.1016/j.cell.2022.01.007. Epub 2022 Feb 2. 10.1016/j.cell.2022.01.007 PubMed 35114111