pAAV_hSyn-fDIO-somQuasAr6a-EGFP-P2A-sombC1C2TG
(Plasmid
#183537)
-
PurposeVoltage indicator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-hSyn
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4561
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesomQuasAr6a-EGFP-P2A-sombC1C2TG
-
SpeciesSynthetic
-
Insert Size (bp)3299
-
MutationNone
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ccacgcgaggcgcgagatag
- 3′ sequencing primer GAATACCAGTCAATCTTTCAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_hSyn-fDIO-somQuasAr6a-EGFP-P2A-sombC1C2TG was a gift from Karl Deisseroth (Addgene plasmid # 183537 ; http://n2t.net/addgene:183537 ; RRID:Addgene_183537) -
For your References section:
All-optical physiology resolves a synaptic basis for behavioral timescale plasticity. Fan LZ, Kim DK, Jennings JH, Tian H, Wang PY, Ramakrishnan C, Randles S, Sun Y, Thadhani E, Kim YS, Quirin S, Giocomo L, Cohen AE, Deisseroth K. Cell. 2023 Feb 2;186(3):543-559.e19. doi: 10.1016/j.cell.2022.12.035. Epub 2023 Jan 19. 10.1016/j.cell.2022.12.035 PubMed 36669484