pPyCAG-tagBFP-3xNLS-IRES-Hph
(Plasmid
#183608)
-
PurposeMammalian expression vector for tagBFP-3xNLS from the CAG promoter. Confers hygromycin B resistance.
-
Depositing Lab
-
Depositing OrganizationUniversity of Edinburgh
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 183608-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 183608-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepPyCAG-IRES-Hph
- Backbone size w/o insert (bp) 6789
- Total vector size (bp) 7593
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametagBFP-3xNLS
-
Insert Size (bp)804
- Promoter CAG
-
Tag
/ Fusion Protein
- 3xNLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGCTGGTTGTTGTGCTGT
- 3′ sequencing primer CGCACACCGGCCTTATTCCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 183608-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 183608-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPyCAG-tagBFP-3xNLS-IRES-Hph was a gift from Sally Lowell (Addgene plasmid # 183608 ; http://n2t.net/addgene:183608 ; RRID:Addgene_183608) -
For your References section:
SyNPL: Synthetic notch pluripotent cell lines to monitor and manipulate cell interactions in vitro and in vivo. Malaguti M, Migueles RP, Annoh J, Sadurska D, Blin G, Lowell S. Development. 2022 May 26. pii: 275525. doi: 10.1242/dev.200226. 10.1242/dev.200226 PubMed 35616331