pPyCAG-tagBFP-3xNLS-IRES-Hph
(Plasmid
#183608)
-
PurposeMammalian expression vector for tagBFP-3xNLS from the CAG promoter. Confers hygromycin B resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPyCAG-IRES-Hph
- Backbone size w/o insert (bp) 6789
- Total vector size (bp) 7593
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametagBFP-3xNLS
-
Insert Size (bp)804
- Promoter CAG
-
Tag
/ Fusion Protein
- 3xNLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGCTGGTTGTTGTGCTGT
- 3′ sequencing primer CGCACACCGGCCTTATTCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPyCAG-tagBFP-3xNLS-IRES-Hph was a gift from Sally Lowell (Addgene plasmid # 183608 ; http://n2t.net/addgene:183608 ; RRID:Addgene_183608) -
For your References section:
SyNPL: Synthetic notch pluripotent cell lines to monitor and manipulate cell interactions in vitro and in vivo. Malaguti M, Migueles RP, Annoh J, Sadurska D, Blin G, Lowell S. Development. 2022 May 26. pii: 275525. doi: 10.1242/dev.200226. 10.1242/dev.200226 PubMed 35616331