Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

attB53-Pac-tetO-mCherry-attB53
(Plasmid #183612)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 183612 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    attB53-Pac-TRE-mCherry-attB53 (Addgene 183611)
  • Backbone size w/o insert (bp) 3340
  • Total vector size (bp) 5107
  • Vector type
    RMCE
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tetO-mCherry
  • Insert Size (bp)
    1767
  • Promoter tetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (insert), AscI (backbone) (destroyed during cloning)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGTTTCCCGTTGAATATGGCTC
  • 3′ sequencing primer CTCGACATCGGCAAGGTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    attB53-Pac-tetO-mCherry-attB53 was a gift from Sally Lowell (Addgene plasmid # 183612 ; http://n2t.net/addgene:183612 ; RRID:Addgene_183612)
  • For your References section:

    SyNPL: Synthetic notch pluripotent cell lines to monitor and manipulate cell interactions in vitro and in vivo. Malaguti M, Migueles RP, Annoh J, Sadurska D, Blin G, Lowell S. Development. 2022 May 26. pii: 275525. doi: 10.1242/dev.200226. 10.1242/dev.200226 PubMed 35616331