Skip to main content

pUG34-NES-EGFP-cPHx3
(Plasmid #183669)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183669 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUG34
  • Backbone manufacturer
    Gueldener U, Hegemann JH.
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PLEKHA1
  • Alt name
    TAPP1
  • Species
    H. sapiens (human), X. laevis (frog)
  • Mutation
    Amino acids 169-329 (tandem trimer)
  • Entrez Gene
    PLEKHA1 (a.k.a. TAPP1)
  • Promoter MET25
  • Tag / Fusion Protein
    • X. laevis map2k1.L(32-44)-EGFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aggtggcaccttgtccaattgaac
  • 3′ sequencing primer ataaatagggacctagacttcagg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert from Addgene Plasmid #116855

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUG34-NES-EGFP-cPHx3 was a gift from Sergio Grinstein (Addgene plasmid # 183669 ; http://n2t.net/addgene:183669 ; RRID:Addgene_183669)
  • For your References section:

    Kinase-independent synthesis of 3-phosphorylated phosphoinositides by a phosphotransferase. Walpole GFW, Pacheco J, Chauhan N, Clark J, Anderson KE, Abbas YM, Brabant-Kirwan D, Montano-Rendon F, Liu Z, Zhu H, Brumell JH, Deiters A, Stephens LR, Hawkins PT, Hammond GRV, Grinstein S, Fairn GD. Nat Cell Biol. 2022 Apr 28. pii: 10.1038/s41556-022-00895-y. doi: 10.1038/s41556-022-00895-y. 10.1038/s41556-022-00895-y PubMed 35484249