Skip to main content

pBR_attB(bxb)_ccdB_lox
(Plasmid #183763)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183763 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBR322/pUC
  • Backbone size w/o insert (bp) 300
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression, Cre/Lox, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ccdB
  • Insert Size (bp)
    300

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer CACACATAACCAGGAGGTCAG
  • 3′ sequencing primer TGAAGTCAGCCCCATACGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBR_attB(bxb)_ccdB_lox was a gift from Richard Davis (Addgene plasmid # 183763 ; http://n2t.net/addgene:183763 ; RRID:Addgene_183763)
  • For your References section:

    STRAIGHT-IN enables high-throughput targeting of large DNA payloads in human pluripotent stem cells. Blanch-Asensio A, Grandela C, Brandao KO, de Korte T, Mei H, Ariyurek Y, Yiangou L, Mol MPH, van Meer BJ, Kloet SL, Mummery CL, Davis RP. Cell Rep Methods. 2022 Sep 22;2(10):100300. doi: 10.1016/j.crmeth.2022.100300. eCollection 2022 Oct 24. 10.1016/j.crmeth.2022.100300 PubMed 36313798