pODN-mNG-CfANLN
(Plasmid
#183837)
-
PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in canine cells using CRISPR/Cas9.
-
Depositing Lab
-
Depositing OrganizationConcordia University
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJET1.2
-
Backbone manufacturerThermo Fischer Scientific
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 5709
-
Vector typeMammalian Expression, CRISPR ; Donor template
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCanis familiaris ANLN homology arms with mNeonGreen-linker
-
Alt nameAnillin
-
SpeciesCanis familiaris
-
Insert Size (bp)2735
-
MutationHomology arms contain point mutations to remove the sgRNA target site
-
GenBank ID
-
Tag
/ Fusion Protein
- mNeonGreen-linker (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAACTGCTTTAACACTTGTGCCTG
- 3′ sequencing primer GTTCCTGATGAGGTGGTTAGCATAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains an IS1 element inserted in the lac UV5 promoter. The Lac UV5 promoter is part of the backbone so the insertion is not expected to affect the CRISPR repair template function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pODN-mNG-CfANLN was a gift from Alisa Piekny (Addgene plasmid # 183837 ; http://n2t.net/addgene:183837 ; RRID:Addgene_183837) -
For your References section:
Cytokinetic diversity in mammalian cells is revealed by the characterization of endogenous anillin, Ect2 and RhoA. Husser MC, Ozugergin I, Resta T, Martin VJJ, Piekny AJ. Open Biol. 2022 Nov;12(11):220247. doi: 10.1098/rsob.220247. Epub 2022 Nov 23. 10.1098/rsob.220247 PubMed 36416720