Skip to main content
Addgene

pODN-mNG-CfANLN
(Plasmid #183837)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183837 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJET1.2
  • Backbone manufacturer
    Thermo Fischer Scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 5709
  • Vector type
    Mammalian Expression, CRISPR ; Donor template

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Canis familiaris ANLN homology arms with mNeonGreen-linker
  • Alt name
    Anillin
  • Species
    Canis familiaris
  • Insert Size (bp)
    2735
  • Mutation
    Homology arms contain point mutations to remove the sgRNA target site
  • GenBank ID
  • Tag / Fusion Protein
    • mNeonGreen-linker (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CAACTGCTTTAACACTTGTGCCTG
  • 3′ sequencing primer GTTCCTGATGAGGTGGTTAGCATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains an IS1 element inserted in the lac UV5 promoter. The Lac UV5 promoter is part of the backbone so the insertion is not expected to affect the CRISPR repair template function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pODN-mNG-CfANLN was a gift from Alisa Piekny (Addgene plasmid # 183837 ; http://n2t.net/addgene:183837 ; RRID:Addgene_183837)
  • For your References section:

    Cytokinetic diversity in mammalian cells is revealed by the characterization of endogenous anillin, Ect2 and RhoA. Husser MC, Ozugergin I, Resta T, Martin VJJ, Piekny AJ. Open Biol. 2022 Nov;12(11):220247. doi: 10.1098/rsob.220247. Epub 2022 Nov 23. 10.1098/rsob.220247 PubMed 36416720