pX459-HypaCas9-mR2-CfANLN_sgRNA
(Plasmid
#183879)
-
PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX459V2.0-HypaCas9-mRuby2
- Total vector size (bp) 9955
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCanis familiaris ANLN sgRNA spacer
-
Alt nameAnillin
-
gRNA/shRNA sequenceGGCGATGGACCCGTTTACCG
-
SpeciesCanis familiaris
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer gagggcctatttcccatgattcc
- 3′ sequencing primer ggccatttaccgtaagttatgtaacg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-HypaCas9-mR2-CfANLN_sgRNA was a gift from Alisa Piekny (Addgene plasmid # 183879 ; http://n2t.net/addgene:183879 ; RRID:Addgene_183879) -
For your References section:
Cytokinetic diversity in mammalian cells is revealed by the characterization of endogenous anillin, Ect2 and RhoA. Husser MC, Ozugergin I, Resta T, Martin VJJ, Piekny AJ. Open Biol. 2022 Nov;12(11):220247. doi: 10.1098/rsob.220247. Epub 2022 Nov 23. 10.1098/rsob.220247 PubMed 36416720