OA-986F (AAEL003877-dCas9-VPR)
(Plasmid
#183993)
-
PurposeExpresses dCas9-VPR under the Ae. aegypti polyubiquitin promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183993 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePlasmid #100581
- Backbone size w/o insert (bp) 5246
- Total vector size (bp) 14840
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAEL003877-dCAS9-VPR
-
SpeciesAedes aegypti
-
Insert Size (bp)7134
- Promoter AAEL003887
-
Tag
/ Fusion Protein
- dCas9-VPR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TATCTTTACATGTAGCTTGTGCATTGAA
- 3′ sequencing primer CCGGCCGTTAACTCGAATCG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OA-986F (AAEL003877-dCas9-VPR) was a gift from Omar Akbari (Addgene plasmid # 183993 ; http://n2t.net/addgene:183993 ; RRID:Addgene_183993) -
For your References section:
CRISPR mediated transactivation in the human disease vector Aedes aegypti. Bui M, Dalla Benetta E, Dong Y, Zhao Y, Yang T, Li M, Antoshechkin IA, Buchman A, Bottino-Rojas V, James AA, Perry MW, Dimopoulos G, Akbari OS. PLoS Pathog. 2023 Jan 19;19(1):e1010842. doi: 10.1371/journal.ppat.1010842. eCollection 2023 Jan. 10.1371/journal.ppat.1010842 PubMed 36656895