Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

15x-QUAS-dTomato-T2A-GCaMP6s
(Plasmid #130666)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130666 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Addgene 104875, pBac-ECFP-15xQUAS_TATA-SV40
  • Total vector size (bp) 8747
  • Vector type
    Insect Expression ; Ae. aegypti expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    15xQUAS-dTomato-T2A-GCaMP6s
  • Insert Size (bp)
    3469
  • Promoter 15xQUAS-TATA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCCAGGGTTTTCCCAGTCACGACG
  • 3′ sequencing primer GTCATAGCTGTTTCCTGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Backbone is a gift from Chris Potter, Addgene #104875

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    15x-QUAS-dTomato-T2A-GCaMP6s was a gift from Leslie Vosshall (Addgene plasmid # 130666 ; http://n2t.net/addgene:130666 ; RRID:Addgene_130666)
  • For your References section:

    The ion channel ppk301 controls freshwater egg-laying in the mosquito Aedes aegypti. Matthews BJ, Younger MA, Vosshall LB. Elife. 2019 May 21;8. pii: 43963. doi: 10.7554/eLife.43963. 10.7554/eLife.43963 PubMed 31112133