Skip to main content
Addgene
Open Menu

pEGFP_D2A_tdTomato
(Plasmid #184045)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184045 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 184045-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 184045-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3300
  • Total vector size (bp) 5840
  • Modifications to backbone
    F1 origin removed
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Enhanced Green Fluorescent Protein
  • Alt name
    EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    tdTomato
  • Species
    Synthetic
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cggatctaccATGGTGAGCAAGGGCGA
  • 3′ sequencing primer GAATTAAGCTTTACTACTTGTACAGCTCGTCCATGC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Dual 2A Peptide Sequence
  • Alt name
    P2AT2A
  • Species
    Teschovirus and Thosea asigna virus
  • Insert Size (bp)
    119
  • Promoter CMV

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTGTACAAGtccggaggcagaaagcttggttcc
  • 3′ sequencing primer TGCTCACCATggtagatccgag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP_D2A_tdTomato was a gift from Angela Pannier (Addgene plasmid # 184045 ; http://n2t.net/addgene:184045 ; RRID:Addgene_184045)

  • For your References section:

    Systematic comparison of nonviral gene delivery strategies for efficient co-expression of two transgenes in human mesenchymal stem cells. Kozisek T, Samuelson L, Hamann A, Pannier AK. J Biol Eng. 2023 Dec 7;17(1):76. doi: 10.1186/s13036-023-00394-0. 10.1186/s13036-023-00394-0 PubMed 38062439
Related items:
Commonly requested with: