Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti6-DCX-EGFP
(Plasmid #80599)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80599 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti6/V5-DEST
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 9019
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Doublecortin
  • Alt name
    DCX
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1095
  • GenBank ID
    NM_178152
  • Entrez Gene
    DCX (a.k.a. DBCN, DC, LISX, SCLH, XLIS)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CMV forward (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer EGFP N reverse (cgtcgccgtccagctcgaccag)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti6-DCX-EGFP was a gift from Torsten Wittmann (Addgene plasmid # 80599)
  • For your References section:

    Doublecortin Is Excluded from Growing Microtubule Ends and Recognizes the GDP-Microtubule Lattice. Ettinger A, van Haren J, Ribeiro SA, Wittmann T. Curr Biol. 2016 Jun 20;26(12):1549-55. doi: 10.1016/j.cub.2016.04.020. Epub 2016 May 26. 10.1016/j.cub.2016.04.020 PubMed 27238282