Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FZ-NbPDS
(Plasmid #184268)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184268 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAIDE (a pCambia1300 drivative)
  • Backbone manufacturer
    Qu lab
  • Backbone size w/o insert (bp) 7872
  • Total vector size (bp) 12030
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CPSMV RNA2 cDNA, modified to permit foreign gene insertion between MP and L-CP
  • Species
    Cowpea severe mosaic virus
  • Insert Size (bp)
    4158
  • Mutation
    The protease processing site between MP and L-CP duplicated.
  • GenBank ID
    NC_003544.1
  • Promoter CaMV 35S with duplicated enhancer

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAAACGACAATCTGATCCAAGCTCAA
  • 3′ sequencing primer GAGTTAGCTCACTCATTAGGCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FZ-NbPDS was a gift from Feng Qu (Addgene plasmid # 184268 ; http://n2t.net/addgene:184268 ; RRID:Addgene_184268)
  • For your References section:

    A cowpea severe mosaic virus-based vector simplifies virus-induced gene silencing and foreign protein expression in soybean. Zaulda FA, Yang SH, Han J, Mlotshwa S, Dorrance A, Qu F. Plant Methods. 2022 Oct 28;18(1):116. doi: 10.1186/s13007-022-00950-7. 10.1186/s13007-022-00950-7 PubMed 36307846