pDS2149
(Plasmid
#184275)
-
PurposeTet-on genome insertion system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDS2142
- Total vector size (bp) 10076
-
Modifications to backboneReplacement of the Tet-on system by Te-off, replacement of SAT1 dominant marker by HygR dominant marker
-
Vector typeYeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCatrTA
-
Alt nameTet-on system
-
SpeciesSynthetic
-
Insert Size (bp)984
- Promoter TDH3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer CATCAACAAACTTTACAATC
- 3′ sequencing primer AAAACCAGATTTCCAGATTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDS2149 was a gift from Dominique Sanglard (Addgene plasmid # 184275 ; http://n2t.net/addgene:184275 ; RRID:Addgene_184275)