Skip to main content

pUltra-MDH1-ME1
(Plasmid #184465)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184465 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUltra
  • Backbone manufacturer
    obtained from Addgene (#24129)
  • Backbone size w/o insert (bp) 8326
  • Total vector size (bp) 11021
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Malate dehydrogenase 1
  • Alt name
    MDH1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1002
  • Mutation
    deletion of stop codon
  • GenBank ID
    NM_005917
  • Entrez Gene
    MDH1 (a.k.a. DEE88, EIEE88, HEL-S-32, KAR, MDH-s, MDHA, MGC:1375, MOR2)
  • Promoter UbC
  • Tag / Fusion Protein
    • fused to T2A

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ggatctggagcaacaaacttc
  • 3′ sequencing primer tagctgggccgggattttc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Malic Enzyme 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1719
  • GenBank ID
    NM_002395
  • Entrez Gene
    ME1 (a.k.a. HUMNDME, MES)
  • Promoter UbC

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer gagggcaggggaagtctac
  • 3′ sequencing primer gtatccacatagcgtaaaagg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The sequence for the ME1 was from Addgene Plasmid #49163

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUltra-MDH1-ME1 was a gift from Gerardo Ferbeyre (Addgene plasmid # 184465 ; http://n2t.net/addgene:184465 ; RRID:Addgene_184465)
  • For your References section:

    A hydride transfer complex reprograms NAD metabolism and bypasses senescence. Igelmann S, Lessard F, Uchenunu O, Bouchard J, Fernandez-Ruiz A, Rowell MC, Lopes-Paciencia S, Papadopoli D, Fouillen A, Ponce KJ, Huot G, Mignacca L, Benfdil M, Kalegari P, Wahba HM, Pencik J, Vuong N, Quenneville J, Guillon J, Bourdeau V, Hulea L, Gagnon E, Kenner L, Moriggl R, Nanci A, Pollak MN, Omichinski JG, Topisirovic I, Ferbeyre G. Mol Cell. 2021 Sep 16;81(18):3848-3865.e19. doi: 10.1016/j.molcel.2021.08.028. 10.1016/j.molcel.2021.08.028 PubMed 34547241