Skip to main content
Addgene

pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
(Plasmid #184549)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184549 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLPC
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6080
  • Total vector size (bp) 8892
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Malate dehydogenase 1
  • Alt name
    MDH1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1074
  • GenBank ID
    NM_005917
  • Entrez Gene
    MDH1 (a.k.a. DEE88, EIEE88, HEL-S-32, KAR, MDH-s, MDHA, MGC:1375, MOR2)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer taggcgtgtacggtggga
  • 3′ sequencing primer CTCAAGCGTATTCAACAAGGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Malic Enzyme 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1746
  • GenBank ID
    NM_002395
  • Entrez Gene
    ME1 (a.k.a. HUMNDME, MES)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA tag (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII / BamHI (destroyed during cloning)
  • 3′ cloning site Xho I /Sal I (destroyed during cloning)
  • 5′ sequencing primer CCCTTGTTGAATACGCTTGAG
  • 3′ sequencing primer acctgtaggtttggcaag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ME1 was from (Addgene plasmid #49163)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA was a gift from Gerardo Ferbeyre (Addgene plasmid # 184549 ; http://n2t.net/addgene:184549 ; RRID:Addgene_184549)
  • For your References section:

    A hydride transfer complex reprograms NAD metabolism and bypasses senescence. Igelmann S, Lessard F, Uchenunu O, Bouchard J, Fernandez-Ruiz A, Rowell MC, Lopes-Paciencia S, Papadopoli D, Fouillen A, Ponce KJ, Huot G, Mignacca L, Benfdil M, Kalegari P, Wahba HM, Pencik J, Vuong N, Quenneville J, Guillon J, Bourdeau V, Hulea L, Gagnon E, Kenner L, Moriggl R, Nanci A, Pollak MN, Omichinski JG, Topisirovic I, Ferbeyre G. Mol Cell. 2021 Sep 16;81(18):3848-3865.e19. doi: 10.1016/j.molcel.2021.08.028. 10.1016/j.molcel.2021.08.028 PubMed 34547241