pPbuCas13b-gRNA-NT
(Plasmid
#184568)
-
PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for PbuCas13b in bacteria.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC184
- Backbone size w/o insert (bp) 4218
- Total vector size (bp) 4360
-
Modifications to backboneinserted single-spacer array including promoter in the tetracycline gene
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameConstitutive expression of single-spacer CRISPR array witha nontargeting spacer for PbuCas13b in bacteria.
-
gRNA/shRNA sequenceCTCGTATGTTGTGTGGAATTGTGAGCGGAT
-
SpeciesPrevotella buccae
- Promoter J23119
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer gaaccttcgaaaaaccgccc
- 3′ sequencing primer gacatcaccgatggggaagat
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPbuCas13b-gRNA-NT was a gift from Chase Beisel (Addgene plasmid # 184568 ; http://n2t.net/addgene:184568 ; RRID:Addgene_184568) -
For your References section:
Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413