cyt-GafD-mTurboID-V5
(Plasmid
#184640)
-
PurposeExpresses V5-tagged GlycoID construct: GafD_short-miniTurboID in mammalian cytosol for O-GlcNAc interactome tagging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5372
- Total vector size (bp) 6722
-
Modifications to backboneNone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecyt-GlycoID-V5
-
Alt namecytosol targeted GafD (22-178)--miniTurboID (BirA*), V5-tagged
-
SpeciesEscherichia coli
-
Insert Size (bp)1347
-
MutationGafD -> expressed aa22-178 ; BirA* -> expressed the miniTurboID variant (Alice Ting Lab)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Nuclear export sequence (C terminal on insert)
- V5 tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CMV forward
- 3′ sequencing primer TurboID reverse: TGTTTATCAATCCCCCGGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cyt-GafD-mTurboID-V5 was a gift from Charlie Fehl (Addgene plasmid # 184640 ; http://n2t.net/addgene:184640 ; RRID:Addgene_184640) -
For your References section:
Spatiotemporal Proximity Labeling Tools to Track GlcNAc Sugar-Modified Functional Protein Hubs during Cellular Signaling. Liu Y, Nelson ZM, Reda A, Fehl C. ACS Chem Biol. 2022 Jul 12. doi: 10.1021/acschembio.2c00282. 10.1021/acschembio.2c00282 PubMed 35819414