Skip to main content
Addgene

nuc-GafD-mTurboID-HA
(Plasmid #184641)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184641 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 6809
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nuc-GlycoID-HA
  • Alt name
    nucleus targeted GafD (22-178)--miniTurboID (BirA*), HA-tagged
  • Species
    Escherichia coli
  • Insert Size (bp)
    1440
  • Mutation
    GafD -> expressed 22-178 ; BirA* -> expressed the miniTurboID variant (Alice Ting Lab)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Nuclear localization sequence (C terminal on insert)
    • 3xHA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMV forward
  • 3′ sequencing primer TurboID reverse: TGTTTATCAATCCCCCGGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nuc-GafD-mTurboID-HA was a gift from Charlie Fehl (Addgene plasmid # 184641 ; http://n2t.net/addgene:184641 ; RRID:Addgene_184641)
  • For your References section:

    Spatiotemporal Proximity Labeling Tools to Track GlcNAc Sugar-Modified Functional Protein Hubs during Cellular Signaling. Liu Y, Nelson ZM, Reda A, Fehl C. ACS Chem Biol. 2022 Jul 12. doi: 10.1021/acschembio.2c00282. 10.1021/acschembio.2c00282 PubMed 35819414