pNoROS-CAT
(Plasmid #170152)

• Purpose: Mammalian expression vector encoding a constitutive nucleolar targeted roGFP and a doxycycline inducible nucleolar targeted catalase. Used to study nucleolar oxidation
• Depositing Lab: Dimitri Pestov
• Depositing Organization: Rowan University
  Located in United States of America
• Publication: Sapio et al Front Mol Biosci. 2021 Apr 26;8:678488. doi: 10.3389/fmolb.2021.678488. eCollection 2021.

Backbone

• Vector backbone: pSBtet-GP
• Backbone manufacturer: Eric Kowarz; Addgene plasmid # 60495
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 7800
• Vector type: Mammalian Expression ; genome integration via Sleeping Beauty transposon system
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: catalase
• Species: M. musculus (mouse)
• Insert Size (bp): 1581
• GenBank ID: 12359
• Entrez Gene: Cat (a.k.a. 2210418N07, Ca, Cas, Cas-1, Cas1, Cs-, Cs-1)
• Promoter: TRE promoter
• Tags / Fusion Proteins:
  • Nucleolar Localization Sequence (NoLS) (N terminal on insert)
  • FLAG tag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCGATTAGGCGTGTACGGTG
• 3′ sequencing primer: CTCCCCCTGAACCTGAAACA

Gene/Insert 2

• Gene/Insert name: roGFP2
• Species: Synthetic
• Promoter: RPBSA
• Tag / Fusion Protein:
  • Nucleolar Localization Sequence (NoLS) (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACGGAACTTCGCCTTTCTCT
• 3′ sequencing primer: GAGCGAGTTTCCTTGTCGTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Paul Schumacker, roGFP2 (Addgene plasmid # 49436).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 170152-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 170152-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.