pNoROS-CAT
(Plasmid
#170152)
-
PurposeMammalian expression vector encoding a constitutive nucleolar targeted roGFP and a doxycycline inducible nucleolar targeted catalase. Used to study nucleolar oxidation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSBtet-GP
-
Backbone manufacturerEric Kowarz; Addgene plasmid # 60495
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 7800
-
Vector typeMammalian Expression ; genome integration via Sleeping Beauty transposon system
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namecatalase
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1581
-
GenBank ID12359
-
Entrez GeneCat (a.k.a. 2210418N07, Ca, Cas, Cas-1, Cas1, Cs-, Cs-1)
- Promoter TRE promoter
-
Tags
/ Fusion Proteins
- Nucleolar Localization Sequence (NoLS) (N terminal on insert)
- FLAG tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TCGATTAGGCGTGTACGGTG
- 3′ sequencing primer CTCCCCCTGAACCTGAAACA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameroGFP2
-
SpeciesSynthetic
- Promoter RPBSA
-
Tag
/ Fusion Protein
- Nucleolar Localization Sequence (NoLS) (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGGAACTTCGCCTTTCTCT
- 3′ sequencing primer GAGCGAGTTTCCTTGTCGTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPaul Schumacker, roGFP2 (Addgene plasmid # 49436).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNoROS-CAT was a gift from Dimitri Pestov (Addgene plasmid # 170152 ; http://n2t.net/addgene:170152 ; RRID:Addgene_170152) -
For your References section:
Effects of Hydrogen Peroxide Stress on the Nucleolar Redox Environment and Pre-rRNA Maturation. Sapio RT, Burns CJ, Pestov DG. Front Mol Biosci. 2021 Apr 26;8:678488. doi: 10.3389/fmolb.2021.678488. eCollection 2021. 10.3389/fmolb.2021.678488 PubMed 33981726