pHrD-IRES-Fluc
(Plasmid
#194250)
-
PurposeHuman RNAP1 promoter region driving firefly luciferase expression from IRES. Constructed by Ghoshal, et al. J Biol Chem (2004). Please cite this original manuscript!
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3
- Total vector size (bp) 6135
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
- Promoter human rDNA promoter and beginning of 5' ETS (-410 to +327 of pre-rRNA transcript)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer GACGATAGTCATGCCCCGCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySamson Jacob lab (OSU); manuscript doi: 10.1074/jbc.M309393200
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid was constructed by Samson Jacob lab.
Manuscript citation:
Ghoshal K, Majumder S, Datta J, Motiwala T, Bai S, Sharma SM, Frankel W, Jacob ST. Role of human ribosomal RNA (rRNA) promoter methylation and of methyl-CpG-binding protein MBD2 in the suppression of rRNA gene expression. J Biol Chem. 2004;279(8):6783-93. doi: 10.1074/jbc.M309393200. PubMed PMID: 14610093; PMCID: 2242730.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHrD-IRES-Fluc was a gift from Samson Jacob (Addgene plasmid # 194250 ; http://n2t.net/addgene:194250 ; RRID:Addgene_194250) -
For your References section:
Human pre-60S assembly factors link rRNA transcription to pre-rRNA processing. McCool MA, Buhagiar AF, Bryant CJ, Ogawa LM, Abriola L, Surovtseva YV, Baserga SJ. RNA. 2022 Nov 2. pii: rna.079149.122. doi: 10.1261/rna.079149.122. 10.1261/rna.079149.122 PubMed 36323459