pCW-OVOL2-HA
(Plasmid
#184737)
-
PurposeDoxycycline-inducible lentiviral expression of OVOL2
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184737 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCW empty vector (Addgene plasmid #184708)
- Backbone size w/o insert (bp) 7600
- Total vector size (bp) 8500
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameovo like zinc finger 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)876
-
GenBank ID58495
-
Entrez GeneOVOL2 (a.k.a. CHED, CHED1, CHED2, EUROIMAGE566589, PPCD1, ZNF339)
- Promoter Tet ON
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer CACATTCTTCACGTCCGTTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhuman OVOL2-HA was cloned from plasmid MSCV-OVOL2-HA (Manzotti et al. DOI:10.1158/1078-0432.CCR-18-2364)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-OVOL2-HA was a gift from Alessia Ciarrocchi & Gloria Manzotti (Addgene plasmid # 184737 ; http://n2t.net/addgene:184737 ; RRID:Addgene_184737) -
For your References section:
OVOL2 impairs RHO GTPase signaling to restrain mitosis and aggressiveness of Anaplastic Thyroid Cancer. Gugnoni M, Manzotti G, Vitale E, Sauta E, Torricelli F, Reggiani F, Pistoni M, Piana S, Ciarrocchi A. J Exp Clin Cancer Res. 2022 Mar 25;41(1):108. doi: 10.1186/s13046-022-02316-2. 10.1186/s13046-022-02316-2 PubMed 35337349