pPL001-BBTK
(Plasmid #184751)

• Purpose: Big-IN positive control payload encoding EF1a-driven GFP-T2A-BSD. Harbors a backbone counterselectable TK cassette.
• Depositing Lab: Jef Boeke
• Publication: Brosh et al Proc Natl Acad Sci U S A. 2021 Mar 9;118(10). pii: 2023952118. doi: 10.1073/pnas.2023952118.

Backbone

• Vector backbone: pLM1110_LEU2 with a HSV-ΔTK counterselectable marker cassette
• Backbone manufacturer: The Center for Synthetic Regulatory Genetics at NYU Langone Health
• Backbone size w/o insert (bp): 11564
• Total vector size (bp): 14183
• Vector type: Mammalian Expression, Mouse Targeting, Cre/Lox, Synthetic Biology ; Recombinase-mediated cassette exchange (RMCE)
• Selectable markers: Blasticidin ; HSV1-ΔTK counterselectable backbone marker (driven by a human PGK1 promoter)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): TransforMax EPI300
• Growth instructions: Copy number induction is recommended for high yield preps. See Lucigen’s growth and copy number induction protocol for TransforMax EPI300 cells.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: pEF1a-eGFP-T2A-BSD-bGHpA
• Alt name: Human EF1a promoter driven CDS containing eGFP, T2A peptide and a blasticidin resistance gene. Bovine Growth Hormone Terminator.
• Species: H. sapiens (human), B. taurus (bovine)
• Insert Size (bp): 2619
• Promoter: EF1a

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TGATCTCGCCCCGAGAACTG
• 3′ sequencing primer: TCTATACCCGGGATCCCCAC

Resource Information

• Supplemental Documents:
  • pPL001-BBTK.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note plasmid contains an IS1 element. Depositor confirms this is not a concern for function.