pAAV-OTp-mCherry
(Plasmid
#184754)
-
PurposeTo drive mCherry under the control of mouse oxytocin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184754 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturern/a
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 7361
-
Modifications to backbonen/a
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsn/a
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesDiscosoma sp
-
Insert Size (bp)711
- Promoter mouse Oxytocin promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer tgctgtcaccctctttagac
- 3′ sequencing primer acgggaagcaatagcatgat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-OTp-mCherry was a gift from Kazunari Miyamichi (Addgene plasmid # 184754 ; http://n2t.net/addgene:184754 ; RRID:Addgene_184754) -
For your References section:
Plasticity of neural connections underlying oxytocin-mediated parental behaviors of male mice. Inada K, Hagihara M, Tsujimoto K, Abe T, Konno A, Hirai H, Kiyonari H, Miyamichi K. Neuron. 2022 Apr 12. pii: S0896-6273(22)00304-X. doi: 10.1016/j.neuron.2022.03.033. 10.1016/j.neuron.2022.03.033 PubMed 35443152