pAAV-SYN-L-sDarken
(Plasmid
#184798)
-
PurposeLow affinity version of the Serotonin Sensor sDarken under the control of a hSyn Promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184798 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4368
- Total vector size (bp) 6048
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameL-sDarken
-
SpeciesSynthetic
-
Insert Size (bp)1680
-
GenBank ID3350
- Promoter hSyn
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCAAATGGGCGGTAGGCGT
- 3′ sequencing primer AACCATTATAAGCTGCAATAAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.03.10.483799 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SYN-L-sDarken was a gift from Olivia Masseck (Addgene plasmid # 184798 ; http://n2t.net/addgene:184798 ; RRID:Addgene_184798) -
For your References section:
Next generation genetically encoded fluorescent sensors for serotonin. Kubitschke M, Muller M, Wallhorn L, Pulin M, Mittag M, Pollok S, Ziebarth T, Bremshey S, Gerdey J, Claussen KC, Renken K, Gross J, Gneisse P, Meyer N, Wiegert JS, Reiner A, Fuhrmann M, Masseck OA. Nat Commun. 2022 Dec 6;13(1):7525. doi: 10.1038/s41467-022-35200-w. 10.1038/s41467-022-35200-w PubMed 36473867