pcloDF-kan
              
              
                (Plasmid
                
                #184837)
              
            
            
            
          - 
            Purpose(Empty Backbone) Backbone that confers Kanamycin resistance, contains cloDF ori
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepUA66
- Backbone size (bp) 2608
- 
              Modifications to backboneorigin pSC101 was exchanged with cloDF
- 
              Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberLow Copy
Cloning Information
- 5′ sequencing primer TATCACGAGGCCCTTTCGTC
- 3′ sequencing primer gtgagctatgagaaagcgccac (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pcloDF-kan was a gift from Chase Beisel (Addgene plasmid # 184837 ; http://n2t.net/addgene:184837 ; RRID:Addgene_184837)
- 
                For your References section: Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413
 
    
 
                         
             
            