Skip to main content

pPJ23116-MS2-rep
(Plasmid #184842)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184842 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUA66
  • Backbone size w/o insert (bp) 3487
  • Total vector size (bp) 5205
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Replicase gene MS2 phage
  • Alt name
    rep
  • Species
    MS2 bacteriophage
  • Insert Size (bp)
    1718
  • Promoter J23116

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TATCACGAGGCCCTTTCGTC
  • 3′ sequencing primer TGTCCTACTCAGGAGAGCGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Elena Vialetto

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPJ23116-MS2-rep was a gift from Chase Beisel (Addgene plasmid # 184842 ; http://n2t.net/addgene:184842 ; RRID:Addgene_184842)
  • For your References section:

    Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413