pMA3735
(Plasmid
#184848)
-
PurposegRNA cloning using blue-white screening for recombinants
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184848 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMA3735
-
Backbone manufacturerAlexeyev lab
- Backbone size w/o insert (bp) 3008
- Total vector size (bp) 3421
-
Modifications to backboneNone
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsNone
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLacZalpha
-
SpeciesE. coli
-
Insert Size (bp)413
-
Mutationalpha-fragment of LacZ
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer atttcttgggtagtttgcag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA3735 was a gift from Mikhail Alexeyev (Addgene plasmid # 184848 ; http://n2t.net/addgene:184848 ; RRID:Addgene_184848) -
For your References section:
A Method for In Situ Reverse Genetic Analysis of Proteins Involved mtDNA Replication. Kozhukhar N, Spadafora D, Rodriguez YAR, Alexeyev MF. Cells. 2022 Jul 11;11(14). pii: cells11142168. doi: 10.3390/cells11142168. 10.3390/cells11142168 PubMed 35883613
Map uploaded by the depositor.
