Skip to main content

pMA3735
(Plasmid #184848)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184848 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 184848-D50 50 μg of DNA in Tris buffer $495
DNA 184848-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pMA3735
  • Backbone manufacturer
    Alexeyev lab
  • Backbone size w/o insert (bp) 3008
  • Total vector size (bp) 3421
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    None
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LacZalpha
  • Species
    E. coli
  • Insert Size (bp)
    413
  • Mutation
    alpha-fragment of LacZ
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer atttcttgggtagtttgcag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMA3735 was a gift from Mikhail Alexeyev (Addgene plasmid # 184848 ; http://n2t.net/addgene:184848 ; RRID:Addgene_184848)
  • For your References section:

    A Method for In Situ Reverse Genetic Analysis of Proteins Involved mtDNA Replication. Kozhukhar N, Spadafora D, Rodriguez YAR, Alexeyev MF. Cells. 2022 Jul 11;11(14). pii: cells11142168. doi: 10.3390/cells11142168. 10.3390/cells11142168 PubMed 35883613