pCytERM-mTagBFP2
(Plasmid
#184940)
-
PurposeER Visualization (OSER assay) Expresses mTagBFP2 in fusion with N-terminal part of p450
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepN1
- Backbone size w/o insert (bp) 3948
- Total vector size (bp) 4788
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCytERM-mTagBFP2
-
SpeciesSynthetic
-
Insert Size (bp)840
-
GenBank IDNM_001171120.1
- Promoter CMV
-
Tag
/ Fusion Protein
- mTagBFP2 (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGGCCCGGGATCCACCGGTCgccaccatgagcgagctgattaagg
- 3′ sequencing primer gattatgatctagagtcgcggccgcttaattaagcttgtgccccagtttgctaggg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCytERM-mTagBFP2 was a gift from Kiryl Piatkevich (Addgene plasmid # 184940 ; http://n2t.net/addgene:184940 ; RRID:Addgene_184940) -
For your References section:
Dual-expression system for blue fluorescent protein optimization. Papadaki S, Wang X, Wang Y, Zhang H, Jia S, Liu S, Yang M, Zhang D, Jia JM, Koster RW, Namikawa K, Piatkevich KD. Sci Rep. 2022 Jun 17;12(1):10190. doi: 10.1038/s41598-022-13214-0. 10.1038/s41598-022-13214-0 PubMed 35715437