Skip to main content
Addgene

pcDNA3_mScarlet-LAMP1
(Plasmid #185138)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185138 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 7382
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lysosome-associated membrane glycoprotein 1
  • Alt name
    LAMP1
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    1965
  • Mutation
    deleted amino acids 1-21 of LAMP1
  • Entrez Gene
    Lamp1 (a.k.a. LGP120)
  • Promoter CMV
  • Tag / Fusion Protein
    • mScarlet (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid will send mScarlet to the lumenal side of the lysosome (LAMP1 N terminus) so that it can be used for lysosomal pH sensing.

This plasmid is described in a published paper that does not have a PubMed ID. Please cite as DOI: https://doi.org/10.5281/zenodo.6363342

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3_mScarlet-LAMP1 was a gift from Andrew York (Addgene plasmid # 185138 ; http://n2t.net/addgene:185138 ; RRID:Addgene_185138)
  • For your References section:

    mScarlet fluorescence lifetime reports lysosomal pH quantitatively. Lazzari-Dean JR, Ingaramo MC, Wang JCK, Yong J, Ingaramo M. (2022), doi: 10.5281/zenodo.6363342 10.5281/zenodo.6363342