pcDNA3_mScarlet-LAMP1
(Plasmid
#185138)
-
PurposeExpresses mScarlet in mammalian lysosomes for pH quantification with fluorescence lifetime
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 7382
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLysosome-associated membrane glycoprotein 1
-
Alt nameLAMP1
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)1965
-
Mutationdeleted amino acids 1-21 of LAMP1
-
Entrez GeneLamp1 (a.k.a. LGP120)
- Promoter CMV
-
Tag
/ Fusion Protein
- mScarlet (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid will send mScarlet to the lumenal side of the lysosome (LAMP1 N terminus) so that it can be used for lysosomal pH sensing.
This plasmid is described in a published paper that does not have a PubMed ID. Please cite as DOI: https://doi.org/10.5281/zenodo.6363342
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3_mScarlet-LAMP1 was a gift from Andrew York (Addgene plasmid # 185138 ; http://n2t.net/addgene:185138 ; RRID:Addgene_185138) -
For your References section:
mScarlet fluorescence lifetime reports lysosomal pH quantitatively. Lazzari-Dean JR, Ingaramo MC, Wang JCK, Yong J, Ingaramo M. (2022), doi: 10.5281/zenodo.6363342 10.5281/zenodo.6363342