Skip to main content

pDisplay-GRAB_OT1.0
(Plasmid #185384)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185384 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDisplay
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6546
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GPCR activation based oxytocin sensor GRAB_OT1.0
  • Species
    B. taurus (bovine)
  • Insert Size (bp)
    1983
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGGCGGTAGGCGTGTA
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDisplay-GRAB_OT1.0 was a gift from Yulong Li (Addgene plasmid # 185384 ; http://n2t.net/addgene:185384 ; RRID:Addgene_185384)
  • For your References section:

    A genetically encoded sensor measures temporal oxytocin release from different neuronal compartments. Qian T, Wang H, Wang P, Geng L, Mei L, Osakada T, Wang L, Tang Y, Kania A, Grinevich V, Stoop R, Lin D, Luo M, Li Y. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01561-2. 10.1038/s41587-022-01561-2 PubMed 36593404