pOmniBac zz TEV YBBR TRF2
(Plasmid
#185443)
-
PurposeExpresses human TRF2 with a zz affinity tag, YBBR labeling site, and TEV cleavage site in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185443 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepOmnibac
- Backbone size w/o insert (bp) 4560
- Total vector size (bp) 6723
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTRF2
-
Alt nametelomeric repeat-binding factor 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2163
-
GenBank IDNM_005652.5
-
Entrez GeneTERF2 (a.k.a. TRBF2, TRF2)
-
Tags
/ Fusion Proteins
- ZZ (N terminal on insert)
- YBBR (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAGACGCAAATTCCGCGGGGAAG
- 3′ sequencing primer CCTCTACAAATGTGGTATGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOmniBac zz TEV YBBR TRF2 was a gift from Ahmet Yildiz (Addgene plasmid # 185443 ; http://n2t.net/addgene:185443 ; RRID:Addgene_185443) -
For your References section:
Compartmentalization of telomeres through DNA-scaffolded phase separation. Jack A, Kim Y, Strom AR, Lee DSW, Williams B, Schaub JM, Kellogg EH, Finkelstein IJ, Ferro LS, Yildiz A, Brangwynne CP. Dev Cell. 2022 Jan 24;57(2):277-290.e9. doi: 10.1016/j.devcel.2021.12.017. 10.1016/j.devcel.2021.12.017 PubMed 35077681