pBig1a zz TEV YBBR RAP1 ZZ TEV TRF2
(Plasmid
#185449)
-
PurposeCoexpresses human RAP1 with an MBP affinity tag, YBBR site, and TEV site, and human TRF2 with a zz tag and TEV site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185449 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBig1a
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 11580
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Streptomycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameTRF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1626
-
GenBank IDNP_005643.2
-
Entrez GeneTERF2 (a.k.a. TRBF2, TRF2)
-
Tag
/ Fusion Protein
- ZZ (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CACCGTCAGCCGGGGCTGAACTTTCGTTTTC
- 3′ sequencing primer CCAGCAGAAGATGCTGCGCTTCCTGGAGAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRAP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
GenBank IDNM_018975.4
-
Entrez GeneTERF2IP (a.k.a. DRIP5, RAP1)
-
Tags
/ Fusion Proteins
- MBP (N terminal on insert)
- YBBR (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CTA CGT GAA GGA AAA TGC CC
- 3′ sequencing primer CGA GTG CTG CGT GAG CGA GC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBig1a zz TEV YBBR RAP1 ZZ TEV TRF2 was a gift from Ahmet Yildiz (Addgene plasmid # 185449 ; http://n2t.net/addgene:185449 ; RRID:Addgene_185449) -
For your References section:
Compartmentalization of telomeres through DNA-scaffolded phase separation. Jack A, Kim Y, Strom AR, Lee DSW, Williams B, Schaub JM, Kellogg EH, Finkelstein IJ, Ferro LS, Yildiz A, Brangwynne CP. Dev Cell. 2022 Jan 24;57(2):277-290.e9. doi: 10.1016/j.devcel.2021.12.017. 10.1016/j.devcel.2021.12.017 PubMed 35077681