Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW57-mcGAS-LL/RK-NLS/D307A
(Plasmid #185459)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 185459 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCW57-MCS1-P2A-MCS2 (Hygro)
  • Backbone manufacturer
    Adam Karpf
  • Backbone size w/o insert (bp) 8185
  • Total vector size (bp) 9805
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    cGAS
  • Alt name
    MB21D1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1647
  • Mutation
    L157R, L159K, D307A
  • GenBank ID
    NM_173386
  • Tags / Fusion Proteins
    • SV40 NLS (C terminal on insert)
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGTATGTCGAGGTAGGCGTG
  • 3′ sequencing primer GTGAAGAATGTGCGAGACCCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57-mcGAS-LL/RK-NLS/D307A was a gift from Shitao Li (Addgene plasmid # 185459 ; http://n2t.net/addgene:185459 ; RRID:Addgene_185459)
  • For your References section:

    Nuclear soluble cGAS senses double-stranded DNA virus infection. Wu Y, Song K, Hao W, Li J, Wang L, Li S. Commun Biol. 2022 May 10;5(1):433. doi: 10.1038/s42003-022-03400-1. 10.1038/s42003-022-03400-1 PubMed 35538147