Skip to main content

pWPI-N1ICD
(Plasmid #185525)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185525 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pWPI
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 11103
  • Total vector size (bp) 13529
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NOTCH1 intracellular domain
  • Alt name
    N1ICD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2426
  • Entrez Gene
    NOTCH1 (a.k.a. AOS5, AOVD1, TAN1, hN1)
  • Promoter EF-1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWPI-N1ICD was a gift from Sean Palecek & Eric Shusta (Addgene plasmid # 185525 ; http://n2t.net/addgene:185525 ; RRID:Addgene_185525)
  • For your References section:

    Notch3 directs differentiation of brain mural cells from human pluripotent stem cell-derived neural crest. Gastfriend BD, Snyder ME, Holt HE, Daneman R, Palecek SP, Shusta EV. Sci Adv. 2024 Feb 2;10(5):eadi1737. doi: 10.1126/sciadv.adi1737. Epub 2024 Feb 2. 10.1126/sciadv.adi1737 PubMed 38306433