pWPI-N1ICD
(Plasmid
#185525)
-
PurposeConstitutive overexpression of human NOTCH1 intracellular domain
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185525 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepWPI
-
Backbone manufacturerDidier Trono
- Backbone size w/o insert (bp) 11103
- Total vector size (bp) 13529
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNOTCH1 intracellular domain
-
Alt nameN1ICD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2426
-
Entrez GeneNOTCH1 (a.k.a. AOS5, AOVD1, TAN1, hN1)
- Promoter EF-1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CCTCACATTGCCAAAAGACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWPI-N1ICD was a gift from Sean Palecek & Eric Shusta (Addgene plasmid # 185525 ; http://n2t.net/addgene:185525 ; RRID:Addgene_185525) -
For your References section:
Notch3 directs differentiation of brain mural cells from human pluripotent stem cell-derived neural crest. Gastfriend BD, Snyder ME, Holt HE, Daneman R, Palecek SP, Shusta EV. Sci Adv. 2024 Feb 2;10(5):eadi1737. doi: 10.1126/sciadv.adi1737. Epub 2024 Feb 2. 10.1126/sciadv.adi1737 PubMed 38306433