Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #91897)


Item Catalog # Description Quantity Price (USD)
Plasmid 91897 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    David Root lab
  • Backbone size w/o insert (bp) 9396
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    Notch1 intracellular domain
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    codons 1770 to 2555 of human NOTCH1
  • GenBank ID
  • Entrez Gene
    NOTCH1 (a.k.a. AOS5, AOVD1, TAN1, hN1)
  • Promoter TRE promoter, Tet ON

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert DNA obtained by PCR from MIG-NICD plasmid (Dr. Warren Pear)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLIX-hN1ICD was a gift from Julien Sage (Addgene plasmid # 91897 ; ; RRID:Addgene_91897)