pGL3Luc-5XNF-kappaB
(Plasmid
#185695)
-
PurposeReporter plasmid with a double-strand oligonucleotides that contain five repeats of NF-kappaB binding consensus sequence (5'-GGGGAATTTCC-3').
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3promoter
- Backbone size w/o insert (bp) 5010
- Total vector size (bp) 5099
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNF-kappaB
-
Alt nameNFkB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)88
-
GenBank IDU47298
-
Entrez GeneNFKB1 (a.k.a. CVID12, EBP-1, KBF1, NF-kB, NF-kB1, NF-kappa-B1, NF-kappaB, NF-kappabeta, NFKB-p105, NFKB-p50, NFkappaB)
- Promoter NF-kappaB binding site
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (not destroyed)
- 3′ cloning site SmaI (unknown if destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3Luc-5XNF-kappaB was a gift from Esther López-Bayghen (Addgene plasmid # 185695 ; http://n2t.net/addgene:185695 ; RRID:Addgene_185695) -
For your References section:
EAAT1-dependent slc1a3 Transcriptional Control depends on the Substrate Translocation Process. Hernandez-Melchor D, Ramirez-Martinez L, Cid L, Palafox-Gomez C, Lopez-Bayghen E, Ortega A. ASN Neuro. 2022 Jan-Dec;14:17590914221116574. doi: 10.1177/17590914221116574. 10.1177/17590914221116574 PubMed 35903937