pUb-HisUb-Ubc9-ChE1 v4.5
(Plasmid
#185756)
-
PurposeBacterial expression of His-Ub, Ubc9 and ChE1 v4.5
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185756 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSUMO1
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameHis-Ub
-
Insert Size (bp)312
- Promoter T7
-
Tag
/ Fusion Protein
- His6 (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer aggagatataccatgggcagc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameUbc9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)474
-
MutationK14R
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer aagaaggagatatacatatgtcc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameChE1 v4.5
-
Insert Size (bp)3051
- Promoter T7
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gaaggagatatacatatggcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUb-HisUb-Ubc9-ChE1 v4.5 was a gift from Jeffrey Bode (Addgene plasmid # 185756 ; http://n2t.net/addgene:185756 ; RRID:Addgene_185756) -
For your References section:
Site-Specific Protein Ubiquitylation Using an Engineered, Chimeric E1 Activating Enzyme and E2 SUMO Conjugating Enzyme Ubc9. Akimoto G, Fernandes AP, Bode JW. ACS Cent Sci. 2022 Feb 23;8(2):275-281. doi: 10.1021/acscentsci.1c01490. Epub 2022 Feb 9. 10.1021/acscentsci.1c01490 PubMed 35237717