ubc-nls-pcp-5xSunTag (SRv1)
              
              
                (Plasmid
                
                #185797)
              
            
            
            
          - 
            Purposepcp-5xSunTag component for SunRISER SRv1
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185797 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepHAGE-UbiC
 - Total vector size (bp) 7136
 - 
              Vector typeMammalian Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert namepcp-5xSunTag
 - 
                    SpeciesSynthetic
 - Promoter human ubiquitin C promoter
 - 
    
        Tags
        / Fusion Proteins
    
- NLS (N terminal on insert)
 - HA (N terminal on insert)
 - FactorXa site (N terminal on insert)
 
 
Cloning Information
- Cloning method Unknown
 - 5′ sequencing primer hUBCpro-F2 CGCCGATGATTATATAAGGA
 - 3′ sequencing primer GTTTACCGCGGTGCCTGA (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            Article Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
ubc-nls-pcp-5xSunTag (SRv1) was a gift from Robin Lee (Addgene plasmid # 185797 ; http://n2t.net/addgene:185797 ; RRID:Addgene_185797) - 
                
For your References section:
Long-term imaging of individual mRNA molecules in living cells. Guo Y, Lee REC. Cell Rep Methods. 2022 May 25;2(6):100226. doi: 10.1016/j.crmeth.2022.100226. eCollection 2022 Jun 20. 10.1016/j.crmeth.2022.100226 PubMed 35784652