Skip to main content

pCSII-EF/mt-(n1)StayGold
(Plasmid #185823)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185823 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCSII-EF
  • Backbone manufacturer
    Dr. Hiroyuki Miyoshi
  • Backbone size w/o insert (bp) 9133
  • Total vector size (bp) 10036
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mt-(n1)StayGold
  • Species
    Synthetic
  • Insert Size (bp)
    903
  • GenBank ID
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGTTCATTCTCAAGCCTCAGAC
  • 3′ sequencing primer GCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSII-EF/mt-(n1)StayGold was a gift from Atsushi Miyawaki (Addgene plasmid # 185823 ; http://n2t.net/addgene:185823 ; RRID:Addgene_185823)
  • For your References section:

    A highly photostable and bright green fluorescent protein. Hirano M, Ando R, Shimozono S, Sugiyama M, Takeda N, Kurokawa H, Deguchi R, Endo K, Haga K, Takai-Todaka R, Inaura S, Matsumura Y, Hama H, Okada Y, Fujiwara T, Morimoto T, Katayama K, Miyawaki A. Nat Biotechnol. 2022 Apr 25. pii: 10.1038/s41587-022-01278-2. doi: 10.1038/s41587-022-01278-2. 10.1038/s41587-022-01278-2 PubMed 35468954