pHPSE-P6
(Plasmid
#185907)
-
PurposeEngineered Human Heparanase mutant for e.coli expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 6737
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsinduce with 0.05 mM IPTG at an OD of 0.6-1.5. Spin down after 3 hours post induction
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameHPSE1
-
Alt nameHPSE-8 kDa subunit
-
SpeciesH. sapiens (human)
-
Insert Size (bp)207
-
GenBank ID
-
Entrez GeneHPSE (a.k.a. HPA, HPA1, HPR1, HPSE1, HSE1)
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer atgcgtccggcgtaga
- 3′ sequencing primer gattatgcggccgtgtacaa (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHPSE1
-
Alt nameHPSE-50kDa subunit
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1166
-
Entrez GeneHPSE (a.k.a. HPA, HPA1, HPR1, HPSE1, HSE1)
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ttgtacacggccgcataatc
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHPSE-P6 was a gift from Colin Jackson (Addgene plasmid # 185907 ; http://n2t.net/addgene:185907 ; RRID:Addgene_185907) -
For your References section:
Computational design and experimental characterisation of a stable human heparanase variant. Whitefield C, Hong N, Mitchell JA, Jackson CJ. RSC Chem Biol. 2022 Feb 15;3(3):341-349. doi: 10.1039/d1cb00239b. eCollection 2022 Mar 9. 10.1039/d1cb00239b PubMed 35382258