Skip to main content

pHPSE-P6
(Plasmid #185907)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185907 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 6737
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    induce with 0.05 mM IPTG at an OD of 0.6-1.5. Spin down after 3 hours post induction
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    HPSE1
  • Alt name
    HPSE-8 kDa subunit
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    207
  • GenBank ID
  • Entrez Gene
    HPSE (a.k.a. HPA, HPA1, HPR1, HPSE1, HSE1)
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer atgcgtccggcgtaga
  • 3′ sequencing primer gattatgcggccgtgtacaa
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HPSE1
  • Alt name
    HPSE-50kDa subunit
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1166
  • Entrez Gene
    HPSE (a.k.a. HPA, HPA1, HPR1, HPSE1, HSE1)
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ttgtacacggccgcataatc
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHPSE-P6 was a gift from Colin Jackson (Addgene plasmid # 185907 ; http://n2t.net/addgene:185907 ; RRID:Addgene_185907)
  • For your References section:

    Computational design and experimental characterisation of a stable human heparanase variant. Whitefield C, Hong N, Mitchell JA, Jackson CJ. RSC Chem Biol. 2022 Feb 15;3(3):341-349. doi: 10.1039/d1cb00239b. eCollection 2022 Mar 9. 10.1039/d1cb00239b PubMed 35382258