pKIF1C_P176L-GFP
(Plasmid
#185980)
-
PurposeMammalian expression of human KIF1C with P176L mutation and GFP tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185980 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-N1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKIF1C
-
Alt nameSAX2
-
Alt nameKIAA0706
-
Alt nameLTXS1
-
SpeciesH. sapiens (human)
-
MutationP176L - mutation causing HSP (SPG58)
-
Entrez GeneKIF1C (a.k.a. LTXS1, SATX2, SAX2, SPAX2, SPG58)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ggaggtctatataagcagag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKIF1C_P176L-GFP was a gift from Anne Straube (Addgene plasmid # 185980 ; http://n2t.net/addgene:185980 ; RRID:Addgene_185980) -
For your References section:
Force generation of KIF1C is impaired by pathogenic mutations. Siddiqui N, Roth D, Toleikis A, Zwetsloot AJ, Cross RA, Straube A. Curr Biol. 2022 Sep 12;32(17):3862-3870.e6. doi: 10.1016/j.cub.2022.07.029. Epub 2022 Aug 11. 10.1016/j.cub.2022.07.029 PubMed 35961316