lentiCRISPR v2-sgCOQ2
(Plasmid
#186025)
-
Purposeknock out COQ2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 12000
- Total vector size (bp) 12000
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCoenzyme Q2, Polyprenyltransferase
-
gRNA/shRNA sequenceATGCTGGGCTCGCGAGCCGC
-
SpeciesH. sapiens (human)
-
GenBank ID
-
Entrez GeneCOQ2 (a.k.a. CL640, COQ10D1, MSA1, PHB:PPT)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer U6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2-sgCOQ2 was a gift from Boyi Gan (Addgene plasmid # 186025 ; http://n2t.net/addgene:186025 ; RRID:Addgene_186025) -
For your References section:
DHODH-mediated ferroptosis defence is a targetable vulnerability in cancer. Mao C, Liu X, Zhang Y, Lei G, Yan Y, Lee H, Koppula P, Wu S, Zhuang L, Fang B, Poyurovsky MV, Olszewski K, Gan B. Nature. 2021 May;593(7860):586-590. doi: 10.1038/s41586-021-03539-7. Epub 2021 May 12. 10.1038/s41586-021-03539-7 PubMed 33981038