Skip to main content
Addgene

pAAV-TetO(3G)-WPRE
(Plasmid #186206)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186206 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-TetO(3G)-GCaMP6
  • Backbone manufacturer
    Akihiro Yamanaka
  • Backbone size (bp) 6197
  • Modifications to backbone
    GCaMP6 between EcoRI and BglII site (blunted) is replaced with WPRE
  • Vector type
    AAV
  • Promoter TetO(3G)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CCTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer CCACCAGCCTTGTCCTAATA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    WPRE: From Karl Deisseroth through Addgene (#20298)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-TetO(3G)-WPRE was a gift from Naoshige Uchida (Addgene plasmid # 186206 ; http://n2t.net/addgene:186206 ; RRID:Addgene_186206)
  • For your References section:

    A gradual temporal shift of dopamine responses mirrors the progression of temporal difference error in machine learning. Amo R, Matias S, Yamanaka A, Tanaka KF, Uchida N, Watabe-Uchida M. Nat Neurosci. 2022 Aug;25(8):1082-1092. doi: 10.1038/s41593-022-01109-2. Epub 2022 Jul 7. 10.1038/s41593-022-01109-2 PubMed 35798979