pAAV-TetO(3G)-WPRE
(Plasmid
#186206)
-
Purpose(Empty Backbone) tTA dependent gene expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-TetO(3G)-GCaMP6
-
Backbone manufacturerAkihiro Yamanaka
- Backbone size (bp) 6197
-
Modifications to backboneGCaMP6 between EcoRI and BglII site (blunted) is replaced with WPRE
-
Vector typeAAV
- Promoter TetO(3G)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CCTCTGCTAACCATGTTCATGC
- 3′ sequencing primer CCACCAGCCTTGTCCTAATA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWPRE: From Karl Deisseroth through Addgene (#20298)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.10.04.325324v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TetO(3G)-WPRE was a gift from Naoshige Uchida (Addgene plasmid # 186206 ; http://n2t.net/addgene:186206 ; RRID:Addgene_186206) -
For your References section:
A gradual temporal shift of dopamine responses mirrors the progression of temporal difference error in machine learning. Amo R, Matias S, Yamanaka A, Tanaka KF, Uchida N, Watabe-Uchida M. Nat Neurosci. 2022 Aug;25(8):1082-1092. doi: 10.1038/s41593-022-01109-2. Epub 2022 Jul 7. 10.1038/s41593-022-01109-2 PubMed 35798979