pCMV-3×FLAG-SLC35A1
(Plasmid
#186282)
-
Purposetransient expression of N-terminal 3×FLAG tagged SLC35A1 isoform a in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186282 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 7262
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSLC35A1
-
SpeciesH. sapiens (human)
-
Entrez GeneSLC35A1 (a.k.a. CDG2F, CMPST, CST, hCST)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3×FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-3×FLAG-SLC35A1 was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 186282 ; http://n2t.net/addgene:186282 ; RRID:Addgene_186282) -
For your References section:
A three-pocket model for substrate coordination and selectivity by the nucleotide sugar transporters SLC35A1 and SLC35A2. Li D, Mukhopadhyay S. J Biol Chem. 2021 Sep;297(3):101069. doi: 10.1016/j.jbc.2021.101069. Epub 2021 Aug 10. 10.1016/j.jbc.2021.101069 PubMed 34384782