pVITRO1-mCherry-CAAX
(Plasmid
#186347)
-
PurposePlasma membrane-targeted mCherry expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepVITRO1-hygro-mcs
-
Backbone manufacturerInvivoGen
- Backbone size w/o insert (bp) 6491
- Total vector size (bp) 6757
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-CAAX
-
SpeciesSynthetic
-
Insert Size (bp)266
-
MutationWT
- Promoter Rat EF1α
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer N/A
- 3′ sequencing primer GGAAAGACCAGGCGGAGTTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVITRO1-mCherry-CAAX was a gift from Chuan-Hsiang Huang (Addgene plasmid # 186347 ; http://n2t.net/addgene:186347 ; RRID:Addgene_186347) -
For your References section:
Deciphering cell signaling networks with massively multiplexed biosensor barcoding. Yang JM, Chi WY, Liang J, Takayanagi S, Iglesias PA, Huang CH. Cell. 2021 Dec 9;184(25):6193-6206.e14. doi: 10.1016/j.cell.2021.11.005. Epub 2021 Nov 26. 10.1016/j.cell.2021.11.005 PubMed 34838160